An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT000009.1

General info


NONCODE TRANSCRIPT IDNONHSAT000009.1
NONCODE Gene IDNONHSAG000002.1
Chromosomechr1
Start Site16996
End Site29348
Strand-
Exon Number11
CNCI Score-0.1965157
Length830
Assemblyhg19
Other transcript VersionsNONHSAT000009.2

Sequence


>NONHSAT000009.1
CGGGAGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCACTCCCTGGCAGGTCAGACCTATGCCGTGCCCTTCATCCAGCCAGCAGATGGCGGATGCCCTGCAGTACCTGCAGAAGGTCTCTGGAGACATCTTCAGCAGAGGTAGAGCAGAGCCGGAGCCAGGTGCAGGCCATTGGAGAGAAGGTCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGTGCCAAGTACCCTGCTCCAGGGCGCCTGCAGGAATATGGCTCCATCTTCACGGGGCCCCCGCCACAGGATCCAGAGCAAGCACCGCCCCCTGGACGAGCGGGCCCTGCAGGAGAAGCTGAAGGACTTTCCTGTGTGCGTGAGCACCAAGCCGGAGCCCGAGGACGATGCAGAAGAGGGACTTGGGGGTCTTCCCAGCAACATCAGCTCTGTCAGCTCCTTGCTGCTCTTCAACACCACCGAGAACCTGGCCCGGCCTGGCTTAGTGGGGACCCAGGGCATCAGACACAGGTACAGCACATAGGCCAGGAGCCAGGGGGTGACGGGTGGCTCGGCTCGGGAGGCCTGGGACCCCACAGTGCACGCTGTGCCCCTGATGGTAGAAGAAGTATGTCTTCCTGGACCCCCTGGCTGGTGCTGTAACAAAGACCCATGTGATGCTGGGGGCGAGAAGCTGTTTGATGCCCCCTTGTCCATCAGCAAGAGAGAGCAGCTGGAACAGCAGGTCCCAGAGAACTACTTCTATGTGCCAGACCTGGGCCAGGTGCCTGAGATTGATGTTCC

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT000005.1
NONHSAT000006.1
NONHSAT000007.1
NONHSAT000008.1
NONHSAT000010.1

Data Sources


Source NameOld Id
noncodeV3Human
PMID26117828PNCT_HSA128060
noncodeV3n345943
NONCODEv4NONHSAT000009
lncipedialnc-FAM138A-8-5