An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT000008.1

General info


NONCODE TRANSCRIPT IDNONHSAT000008.1
NONCODE Gene IDNONHSAG000002.1
Chromosomechr1
Start Site16857
End Site17751
Strand-
Exon Number2
CNCI Score-0.1812693
Length717
Assemblyhg19
Other transcript VersionsNONHSAT000008.2

Sequence


>NONHSAT000008.1
CCCTCTCAGGAGAAGCTGAAGGACTTTCCTGTGTGCGTGAGCACCAAGCCGGAGCCCGAGGACGATGCAGAAGAGGGACTTGGGGGTCTTCCCAGCAACATCAGCTCTGTCAGCTCCTTGCTGCTCTTCAACACCACCGAGAACCTGTATGGCCAGAGGGCAGGGCCGAGGGGTGTGGGCGGGAGGCCCGGCCTGGCTTAGTGGGGACCCAGGGCATCAGACACAGGTACAGCACATAGGCCAGGAGCCAGGGGGTGACGGGTGGCTCGGCTCGGGAGGCCTGGGACCCCACAGTGCACGCTGTGCCCCTGATGATGTGGGAGAGGAACATGGGCTCAGGACAGCGGGTGTCAGCTTGCCTGACCCCCATGTCGCCTCTGTAGGTAGAAGAAGTATGTCTTCCTGGACCCCCTGGCTGGTGCTGTAACAAAGACCCATGTGATGCTGGGGGCAGAGACAGAGGAGAAGCTGTTTGATGCCCCCTTGTCCATCAGCAAGAGAGAGCAGCTGGAACAGCAGGTCCCAGAGAACTACTTCTATGTGCCAGACCTGGGCCAGGTGCCTGAGATTGATGTTCCATCCTACCTGCCTGACCTGCCCGGCATTGCCAACGACCTCATGTACATTGCCGACCTGGGCCCCGGCATTGCCCCCTCTGCCCCTGGCACCATTCCAGAACTGCCCACCTTCCACACTGAGGTAGCCGAGCCTCTCAAG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT000005.1
NONHSAT000006.1
NONHSAT000007.1
NONHSAT000009.1
NONHSAT000010.1

Data Sources


Source NameOld Id
NONCODEv4NONHSAT000008
noncodeV3n385920
PMID26117828PNCT_HSA128059
lncipedialnc-FAM138A-8-7