An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT000008.1

General info


NONCODE TRANSCRIPT IDNONHSAT000008.1
NONCODE Gene IDNONHSAG000002.2
Chromosomechr1
Start Site16857
End Site17751
Strand-
Exon Number2
CNCI Score-0.0741376
Length717
Assemblyhg38
Other transcript VersionsNONHSAT000008.1(old version)

Sequence


>NONHSAT000008.1
CCCTCTCAGGAGAAGCTGAAGGACTTTCCTGTGTGCGTGAGCACCAAGCCGGAGCCCGAGGACGATGCAGAAGAGGGACTTGGGGGTCTTCCCAGCAACATCAGCTCTGTCAGCTCCTTGCTGCTCTTCAACACCACCGAGAACCTGTATGGCCAGAGGGCAGGGCCGAGGGGTGTGGGCGGGAGGCCCGGCCTGGCTTAGTGGGGACCCAGGGCATCAGACACAGGTACAGCACATAGGCCAGGAGCCAGGGGGTGACGGGTGGCTCGGCTCGGGAGGCCTGGGACCCCACAGTGCACGCTGTGCCCCTGATGATGTGGGAGAGGAACATGGGCTCAGGACAGCGGGTGTCAGCTTGCCTGACCCCCATGTCGCCTCTGTAGGTAGAAGAAGTATGTCTTCCTGGACCCCCTGGCTGGTGCTGTAACAAAGACCCATGTGATGCTGGGGGCAGAGACAGAGGAGAAGCTGTTTGATGCCCCCTTGTCCATCAGCAAGAGAGAGCAGCTGGAACAGCAGGTCCCAGAGAACTACTTCTATGTGCCAGACCTGGGCCAGGTGCCTGAGATTGATGTTCCATCCTACCTGCCTGACCTGCCCGGCATTGCCAACGACCTCATGTACATTGCCGACCTGGGCCCCGGCATTGCCCCCTCTGCCCCTGGCACCATTCCAGAACTGCCCACCTTCCACACTGAGGTAGCCGAGCCTCTCAAG

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT150910.1
NONHSAT150911.1
NONHSAT150912.1
NONHSAT000005.2
NONHSAT000006.2
NONHSAT000007.2
NONHSAT000009.2
NONHSAT000010.2

Data Sources


Source NameOld Id
NONCODEv4NONHSAT000008
noncodeV3n385920
PMID26117828PNCT_HSA128059
lncipedialnc-FAM138A-8-7